Isolation and Identification of Salmonella Species Associated with Febrile Patient Using Basic Molecular Techniques

Douye Victor Zige *

Department of Microbiology, Federal University Otuoke, P.M.B. 126, Yenagoa, Bayelsa State, Nigeria.

Faith Iyeoma Omeje

Department of Microbiology, Federal University Otuoke, P.M.B. 126, Yenagoa, Bayelsa State, Nigeria.

*Author to whom correspondence should be addressed.


Abstract

Salmonella enterica, serotype Typhi, remains the predominant Salmonella species causing enteric fever. This disease threatens public health as it is associated with personal hygiene techniques and practices. This study investigates Salmonella typhi using conventional bacteriological techniques as well as polymerase chain reaction (PCR). The results showed that of the four hundred and eighty-six (486) stool samples analyzed, stool cultures revealed 189 putative isolates. These isolates, after identification by conventional biochemical methods, showed 6 isolates (1.23%). The Six (6) confirmed strains were then confirmed PCR with the following set of primers. STR (F) TAT GCC GCT ACA TAT GAT GAG, STR (R) TTA ACG CAG TAA AGA GAG and STN (F) ACT GCT AAA ACC ACT ACT, STN (R) TGG AGA CTT CGG TCG CGT AG and aroC for GGCACCAGTATTGGCCTGCT and aroCs rev CATATGCGCCACAATGTGTTG. The results confirmed one (1) strain of S. typhi and two (2) related serovars (Salmonella typhimuirium). The isolates of Salmonella showed a high rate of antibiotic resistance to gentamicin (100%), augumentin (83.3%), cotrimoxazole (83.3%). In contrast, the isolates were very sensitive to nitrofurantoin (100%) and ofloxacin (83.3%). Others show a different resistance rate. This study confirms the need for multi-step diagnosis for enteric fever to provide appropriate and effective treatment. This finding will guide the use of antibiotics in the treatment of Salmonella infections in the study area and justify the search for new effective antibiotics against multi drug resistance.

Keywords: Typhoid fever, Salmonella typhi, multi drug resistance, PCR


How to Cite

Zige , Douye Victor, and Faith Iyeoma Omeje. 2023. “Isolation and Identification of Salmonella Species Associated With Febrile Patient Using Basic Molecular Techniques”. International Research Journal of Gastroenterology and Hepatology 6 (1):46-52. https://journalirjgh.com/index.php/IRJGH/article/view/75.

Downloads

Download data is not yet available.

References

Feasey NA, Gaskell K, Wong V, Msefula C, Selemani G, Kumwenda S et al. Rapid emergence of multidrug resistant, H58-lineage Salmonella typhi in Blantyre, Malawi. PLOS Negl Trop Dis. 2015;9(4) e0003748.

Schwenk R. Reimagining Water, Sanitation and Hygiene for every child Hand hygiene for all [online]. United nations children’s fund. 2020 [cited Mar 5]. 2023;5. Available:https://www.unicef.org/malawi/stories/reimagining-water-sanitation-and-hygiene-every-child.

Khadka P, Thapaliya J, Thapa S. Susceptibility pattern of Salmonella enterica against commonly prescribed antibiotics, to febrile-paediatric cases, in low-income countries. BMC Pediatr. 2021; 21(1):38.

Akullian A, Ng’Eno E, Matheson AI, Cosmas L, Macharia D, Fields B et al. Environmental transmission of typhoid fever in an urban slum. PLOS Negl Trop Dis. 2015;9(12):e0004212.

Mogasale V, Maskery B, Ochiai RL, Lee JS, Mogasale VV, Ramani E et al. Burden of typhoid fever in low-income and middle-income countries: A systematic, literature-based update with risk-factor adjustment. Lancet Glob Health. 2014;2(10):e570-80.

Zorgani A, Ziglam H. Typhoid fever: Misuse of Widal test in Libya. J Infect Dev Ctries. 2014;8(6):680-7.

Ochiai RL, Acosta CJ, Danovaro-Holliday MC, Baiqing D, Bhattacharya SK, Agtini MD, Bhutta ZA, Canh do G, Ali M, Shin S, Wain J, Page AL, Albert MJ, Farrar J, Abu-Elyazeed R, Pang T, Galindo CM, von Seidlein L, Clemens JD Domi typhoid study group. A study of typhoid fever in five Asian countries: Disease burden and implications for controls. Bull World Health Organ. 2008;86:260-8.

Olopoenia LA, King AL. Widal agglutination test −100 years later: still plagued by controversy. Postgrad Med J. 2000;76(892):80-4.

Adeshina G, Osuagwu N, Okeke C, Ehinmidu J, Bolaji R. Prevalence and susceptibility of Salmonella typhi and Salmonella paratyphi in Zaria, Nigeria. Int J Health Res. 2009;2(4):355-60.

Adachi T, Sagara H, Hirose K, Watanabe H. Fluoroquinolone resistant Salmonella paratyphi A. Emerg Infect Dis. 2005;11(1):172-4.

Filioussis G, Petridou E, Johansson A, Christodoulopoulos G, Kritas SK. Antimicrobial susceptibility and genetic relatedness of Salmonella enterica subsp. enterica serovar Mbandaka strains, isolated from a swine finishing farm in Greece. Afr J Microbiol Res. 2008;2:313-5.

Mordi RM, Momoh MI. Incidence of Proteus species in wound infections and their Sensitivity pattern in the University of Benin Teaching Hospital. Afr J Biotechnol. 2009;8(5):725-30.

Mutai WC, Muigai AWT, Waiyaki P, Kariuki S. Multi-drug resistant Salmonella enterica serovar typhi isolates with reduced susceptibility to ciprofloxacin in Kenya. BMC Microbiol. 2018;18(1):187.

Britto CD, Dyson ZA, Mathias S, Bosco A, Dougan G, Jose S et al. Persistent circulation of a fluoroquinolone-resistant Salmonella enterica Typhi clone in the Indian subcontinent. J Antimicrob Chemother. 2020;75(2):337-41.

Mourad AS, Metwally M, Nour El Deen, A, Threlfall EJ, Rowe B, Mapes T, Hedstrom R, Bourgeois AL, Murphy JR. Multiple-drug-resistant Salmonella typhi. Clin. Infect. Dis. 1993;17:135-136.

Accou-Demartin M, Gaborieau V, Song Y, Roumagnac P, Marchou B, Achtman M et al. Salmonella enterica serotype Typhi with nonclassical quinolone resistance phenotype. Emerg Infect Dis. 2011;17(6): 1091-4.

Hampton MD, Ward LR, Rowe B, Threlfall EJ. Molecular fingerprinting of multidrug-resistant Salmonella enterica serotype Typhi. Emerg Infect Dis. 1998;4(2):317-20.

Haque A, Ahmed N, Peerzada A, Raza A, Bashir S, Abbas G. Utility of PCR in diagnosis of problematic cases of typhoid. Jpn J Infect Dis. 2001;54(6):237-9.

Wallace M, Yousif AA. Spread of multiresistant Salmonella typhi. Lancet. 1993;336:1065-6.